NEET Topic-wise & A
Topic 1: NUCLEIC ACIDS (DNA & RNA) & PACKAGING OF DNA
NEET: Previous Years Questions
01. Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both Statement I and Statement II are false.
(2) Statement I is correct but Statement II is false.
(3) Statement I is incorrect but Statement II is true.
(4) Both Statement I and Statement II are true. (NEET 2023)
✅ (3) Statement I is incorrect but Statement II is true.
02. Which one of the following statements about Histones is wrong?
(1) Histones are organized to form a unit of 8 molecules.
(2) The pH of histones is slightly acidic.
(3) Histones are rich in amino acids - Lysine and Arginine.
(4) Histones carry positive charge in the side chain. (NEET 2021)
✅ (2) The pH of histones is slightly acidic.
03. Complete the flow chart on central dogma.
(1) (a) Replication; (b) Transcription; (c) Transduction; (d) Protein
(2) (a) Translation; (b) Replication; (c) Transcription; (d) Transduction
(3) (a) Replication; (b) Transcription; (c) Translation; (d) Protein
(4) (a) Transduction; (b) Translation; (c) Replication; (d) Protein (NEET 2021)
✅ (3) (a) Replication; (b) Transcription; (c) Translation; (d) Protein
04. If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?
(1) T: 20; G: 30; C: 20
(2) T: 20; G: 20; C: 30
(3) T: 30; G: 20; C: 20
(4) T: 20; G: 25; C: 25 (NEET 2021)
✅ (3) T: 30; G: 20; C: 20
05. Which of the following statements is correct?
(1) Adenine pairs with thymine through three H-bonds.
(2) Adenine does not pair with thymine.
(3) Adenine pairs with thymine through two H-bonds.
(4) Adenine pairs with thymine through one H-bond. (NEET 2020)
✅ (3) Adenine pairs with thymine through two H-bonds.
06. If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6×109 bp, then the length of the DNA is approximately:
(1) 2.2 meters
(2) 2.7 meters
(3) 2.0 meters
(4) 2.5 meters (NEET 2020)
✅ (1) 2.2 meters
07. Purines found both in DNA and RNA are
(1) Adenine & thymine
(2) Adenine & guanine
(3) Guanine & cytosine
(4) Cytosine & thymine (NEET 2019)
✅ (2) Adenine & guanine
08. The association of histone H1 with a nucleosome indicates that
(1) DNA replication is occurring
(2) the DNA is condensed into a chromatin fibre
(3) the DNA double helix is exposed
(4) transcription is occurring. (NEET 2017)
✅ (2) the DNA is condensed into a chromatin fibre
Model Questions
09. Select the odd one.
(1) Adenosine
(2) Guanosine
(3) Cytosine
(4) Thymidine
✅ (3) Cytosine
10. Correct combination that can form an RNA nucleotide is
(1) Adenine + deoxyribose + phosphate
(2) Thymine + ribose + phosphate
(3) Uracil + deoxyribose + phosphate
(4) Uracil + ribose + phosphate
✅ (4) Uracil + ribose + phosphate
11. In some viruses, RNA is present instead of DNA indicating that
(1) Their nucleic acid must combine with host DNA before replication
(2) They cannot replicate
(3) There is no heredity information
(4) RNA can act to transfer heredity
✅ (4) RNA can act to transfer heredity
12. DNA double helix model is proposed based on X-ray diffraction data produced by
(1) Friedrich Miescher
(2) Watson & Crick
(3) Wilkins & Franklin
(4) Erwin Chargaff
✅ (3) Wilkins & Franklin
13. DNA of E. coli has
(1) 4.6x10⁶ bp
(2) 6.6x10⁹ bp
(3) 5386 nucleotides
(4) 48502 bp
✅ (1) 4.6x10⁶ bp
14. Nucleotide arrangement in DNA can be seen by
(1) X-ray crystallography
(2) Electron microscope
(3) Ultracentrifuge
(4) Light microscope
✅ (1) X-ray crystallography
15. RNA differs from DNA in the type of
(1) Purines & pyrimidines
(2) Sugars & purines
(3) Sugars & pyrimidines
(4) Pyrimidine
✅ (3) Sugars & pyrimidines
16. In a DNA segment, cytosine is 18%. Then, adenine is
(1) 64%
(2) 32%
(3) 36%
(4) 18%
✅ (2) 32%
17. Which is true according to Chargaff’s rule?
(1) A+G=T+C
(2) A+T= C+G
(3) A+G/T+C = 2
(4) A+T/C+G=1
✅ (1) A+G=T+C
18. A DNA molecule contains 20,000 base pairs. How many nucleotides would be present in it?
(1) 2000
(2) 40,000
(3) 200,000
(4) 20,000
✅ (2) 40,000
19. A short length of a DNA molecule contains 120 adenine and 120 cytosine bases. The total number of nucleotides in this DNA fragment is
(1) 120
(2) 60
(3) 240
(4) 480
✅ (4) 480
20. Which is correct statement?
(1) DNA and histone are positively charged
(2) DNA and histone are negatively charged
(3) DNA is negatively charged and histone is positively charged
(4) DNA is positively charged and histone is negatively charged
✅ (3) DNA is negatively charged and histone is positively charged
21. Negatively charged DNA is wrapped around histone octamer to give
(1) Nucleotide
(2) Nucleosome
(3) Euchromatin
(4) Heterochromatin
✅ (2) Nucleosome
22. The association of H1 histone with a nucleosome indicates that
(1) DNA replication is occurring
(2) The DNA is condensed into a chromatin fibre
(3) The DNA double helix is exposed
(4) Transcription is occurring
✅ (2) The DNA is condensed into a chromatin fibre
23. Which statement is more correct about the diagram given below?
(1) This diagram represents a unit of chromatin and B & C are proteins.
(2) This diagram represents packaging of DNA helix and C is nucleosome.
(3) This diagram represents chromatin and B is histone octamer.
(4) This diagram represents nucleosome and A is chromosome.
✅ (1) This diagram represents a unit of chromatin and B & C are proteins.
Topic 2: SEARCH FOR GENETIC MATERIAL, PROPERTIES OF GENETIC MATERIAL
NEET: Previous Years Questions
24. Match List I with List II:
Choose the correct answer from the options given below:
(1) A-III, B-II, C-I, D-IV
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-III, C-IV, D-I
(4) A-IV, B-I, C-II, D-III (NEET 2024)
✅ (2) A-III, B-IV, C-I, D-II
25. Unequivocal proof that DNA is the genetic material was first proposed by
(1) Alfred Hershey and Martha Chase
(2) Avery, MacLeod and McCarthy
(3) Wilkins and Franklin
(4) Frederick Griffith (NEET 2023)
✅ (1) Alfred Hershey and Martha Chase
26. Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both Statement I and Statement II are false.
(2) Statement I is true but Statement II is false.
(3) Statement I is false but Statement II is true.
(4) Both Statement I and Statement II are true. (NEET 2023)
✅ (4) Both Statement I and Statement II are true.
27. The final proof for DNA as the genetic material came from the experiments of
(1) Hershey and Chase
(2) Avery, MacLeod and McCarty
(3) Hargobind Khorana
(4) Griffith (NEET 2017)
✅ (1) Hershey and Chase
28. A molecule that can act as a genetic material must fulfill the traits given below, except
(1) it should be able to express itself in the form of ‘Mendelian characters’
(2) it should be able to generate its replica
(3) it should be unstable structurally and chemically
(4) it should provide the scope for slow changes that are required for evolution. (NEET-II 2016)
✅ (3) it should be unstable structurally and chemically
Model Questions
29. What happened when heat killed S cells along with live R cells were injected into the mice?
(1) Mice survived and showed live S cells
(2) Mice died and showed live S cells
(3) Mice survived and showed live R cells
(4) Mice died and showed live R cells
✅ (2) Mice died and showed live S cells
30. The result of which of the following reaction experiments carried out by Avery et.al on Streptococcus pneumoniae has proved conclusively that DNA is the genetic material?
(1) Live R strain + DNA from S strain + RNAase
(2) Live R strain + DNA from S strain + DNAase
(3) Live R strain + Denatured DNA of S strain + Protease
(4) Heat killed R strain + DNA from S strain + DNAase
✅ (2) Live R strain + DNA from S strain + DNAase
31. In Hershey-Chase experiment, radioactive 32P was used to culture bacteriophages which resulted in radioactive
(1) Viral DNA
(2) Bacterial capsule
(3) Viral proteins
(4) Protein capsule of bacteriophage
✅ (1) Viral DNA
32. A molecule that can act as a genetic material must fulfil the traits given below except
(1) It should be able to express itself in the form of Mendelian characters.
(2) It should be able to generate its replica.
(3) It should be unstable structurally and chemically.
(4) It should provide the scope for slow changes that are required for evolution.
✅ (3) It should be unstable structurally and chemically.
33. DNA is more stable than RNA because
(1) DNA is double stranded
(2) Thymine is present
(3) 2’OH is absent in deoxyribose sugar
(4) All of these
✅ (4) All of these
34. Which statement is not correct about RNA?
(1) Sugar contains 2’OH group
(2) It acts as catalyst and genetic material
(3) Number of adenine equals number of uracil
(4) DNA evolved from RNA for stability
✅ (3) Number of adenine equals number of uracil
Topic 3: DNA REPLICATION
NEET: Previous Years Questions
35. Which of the following statement is correct regarding the process of replication in E. coli?
(1) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’→5’
(2) The DNA dependent RNA polymerase catalyses polymerization in one direction that is 5’→3’
(3) The DNA dependent DNA polymerase catalyses polymerization in 5’→3’ as well as 3’→5’direction
(4) The DNA dependent DNA polymerase catalyses polymerization in 5’→3’ direction (NEET 2024)
✅ (4) The DNA dependent DNA polymerase catalyses polymerization in 5’→3’ direction
36. Among eukaryotes, replication of DNA takes place in
(1) S phase
(2) G1 phase
(3) G2 phase
(4) M phase (NEET 2023)
✅ (1) S phase
37. The experimental proof for semi-conservative replication of DNA was first shown in a
(1) Fungus
(2) Bacterium
(3) Plant
(4) Virus (NEET 2018)
✅ (2) Bacterium
38. During DNA replication, Okazaki fragments are used to elongate
(1) the lagging strand towards replication fork
(2) the leading strand away from replication fork
(3) the lagging strand away from the replication fork
(4) the leading strand towards replication fork (NEET 2017)
✅ (3) the lagging strand away from the replication fork
39. Taylor conducted the experiments to prove semi-conservative mode of chromosome replication on
(1) Vinca rosea
(2) Vicia faba
(3) Drosophila melanogaster
(4) E. coli (NEET-II 2016)
✅ (2) Vicia faba
Model Questions
40. Which of the following represents “central dogma” in Molecular biology?
(1) DNA → RNA → Protein
(2) RNA → Protein → DNA
(3) RNA → DNA → Protein
(4) DNA → Protein → RNA
✅ (1) DNA → RNA → Protein
41. Given below are assertion and reason. Point out if both are true with reason being correct explanation (A), both true but reason is not correct explanation (B), assertion true but reason is wrong (C) and both are wrong (D).
Assertion: Watson and Crick provided experiment proof of semiconservative nature of DNA replication.
Reason: RNA polymerase adds nucleotides in replication.
(1) A
(2) B
(3) C
(4) D
✅ (4) D
42. Meselson-Stahl experiment proved
(1) DNA is genetic material
(2) Central dogma
(3) Transformation
(4) Semi-conservative DNA replication
✅ (4) Semi-conservative DNA replication
43. E. coli with completely radioactive DNA was allowed to replicate in non-radioactive medium for 2 generations. Percentage of bacteria with radioactive DNA is
(1) 100%
(2) 50%
(3) 25%
(4) 12.5%
✅ (2) 50%
44. Double chained DNA strand is made radioactive in both of its chains. It is allowed to replicate twice in non-radioactive medium. The result would be
(1) All strands have radioactivity
(2) Half of the strands have radioactivity
(3) 2 strands have radioactivity
(4) Radioactivity is absent in all stands
✅ (3) 2 strands have radioactivity
45. DNA replication in eukaryotes commences
(1) From both ends of a chromosome simultaneously
(2) Several sites along DNA of a chromosome simultaneously
(3) From centromere to either end
(4) From one end of chromosome to other
✅ (2) Several sites along DNA of a chromosome simultaneously
46. A DNA nucleotide chain has AGCTTCGA sequence. The nucleotide sequence of other chain would be
(1) TCGAAGCT
(2) GCTAAGCT
(3) TAGCATAT
(4) GATCCTAG
✅ (1) TCGAAGCT
47. During DNA replication, the strands separated by
(1) DNA polymerase
(2) Topoisomerase
(3) Unwindase/Helicase
(4) Gyrase
✅ (3) Unwindase/Helicase
48. Match the following in column I with column II and choose the correct combination.
(1) a–2, b–3, c–1, d–4
(2) a–1, b–4, c–2, d–3
(3) a–3, b–1, c–4, d–2
(4) a–4, b–2, c–1, d–3
✅ (3) a–3, b–1, c–4, d–2
49. A unit of replication with one origin is called
(1) Recon
(2) Replicon
(3) Codon
(4) Cistron
✅ (2) Replicon
50. Which is not a part of replication fork?
(1) Leading strand
(2) Okazaki fragments
(3) Lagging strand
(4) Terminator site
✅ (4) Terminator site
51. Okazaki fragments are joined together to form a new strand by an enzyme
(1) DNA ligase
(2) RNA primase
(3) DNA polymerase
(4) DNA helicase
✅ (1) DNA ligase
52. DNA synthesis can be measured by estimating incorporation of radio-labelled
(1) Uracil
(2) Ribose sugar
(3) Thymidine
(4) Adenine
✅ (3) Thymidine
Topic 4: TRANSCRIPTION
NEET: Previous Years Questions
53. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end
(1) Repressor, Operator gene, Structural gene
(2) Structural gene, Transposons, Operator gene
(3) Inducer, Repressor, Structural gene
(4) Promotor, Structural gene, Terminator (NEET 2024)
✅ (4) Promotor, Structural gene, Terminator
54. Match List I with List II:
Choose the correct answer from the options given below:
(1) A-II, B-IV, C-I, D-III
(2) A-III, B-II, C-IV, D-I
(3) A-III, B-IV, C-I, D-II
(4) A-IV, B-III, C-I, D-II (NEET 2024)
✅ (4) A-IV, B-III, C-I, D-II
55. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’- TACATGGCAAATATCCATTCA-5’
(1) 5’ -AUGUACCGUUUAUAGGUAAGU-3’
(2) 5’ -AUGUAAAGUUUAUAGGUAAGU-3’
(3) 5’ -AUGUACCGUUUAUAGGGAAGU-3’
(4) 5’ -ATGTACCGTTTATAGGTAAGT-3’ (NEET 2024)
✅ (1) 5’ -AUGUACCGUUUAUAGGUAAGU-3’
56. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows?
5’- AUCGAUCGAUCGAUCGAUCGAUCGAUCG -3’
(1) 3’-UAGCUAGCUAGCUAGCUAGCUAGCUAGC - 5'
(2) 5’- ATCGATCGATCGATCGATCGATCGATCG - 3’
(3) 3’-ATCGATCGATCGATCGATCGATCGATCG - 5'
(4) 5’-UAGCUAGCUAGCUAGCUAGCUAGCUAGC - 3’ (NEET 2023)
✅ (2) 5’- ATCGATCGATCGATCGATCGATCGATCG - 3’
57. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(1) Transcription of tRNA, 5 srRNA and snRNA
(2) Transcription of precursor of mRNA
(3) Transcription of only snRNAs
(4) Transcription of rRNAs (28S, 18S and 5.8S) (NEET 2023)
✅ (1) Transcription of tRNA, 5 srRNA and snRNA
58. What is the role of RNA polymerase III in the process of transcription in eukaryotes?
(1) Transcribes rRNAs (28S, 18S and 5.8S)
(2) Transcribes tRNA, 5s rRNA and snRNA
(3) Transcribes precursor of mRNA
(4) Transcribes only snRNAs (NEET 2021)
✅ (2) Transcribes tRNA, 5s rRNA and snRNA
59. Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?
(1) DNA dependent DNA polymerase
(2) DNA dependent RNA polymerase
(3) DNA Ligase
(4) DNase (NEET 2021)
✅ (2) DNA dependent RNA polymerase
60. Identify the correct statement.
(1) In capping, methyl guanosine triphosphate is added to the 3' end of hnRNA.
(2) RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.
(3) The coding strand in a transcription unit is copied to an mRNA.
(4) Split gene arrangement is characteristic of prokaryotes. (NEET 2021)
✅ (3) The coding strand in a transcription unit is copied to an mRNA.
61. Name the enzyme that facilitates opening of DNA helix during transcription. (NEET 2020)
(1) DNA polymerase
(2) RNA polymerase
(3) DNA ligase
(4) DNA helicase
✅ (4) DNA helicase
62. AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?
(1) AGGUAUCGCAU
(2) UGGTUTCGCAT
(3) ACCUAUGCGAU
(4) UCCAUAGCGUA (NEET 2018)
✅ (1) AGGUAUCGCAU
63. The equivalent of a structural gene is
(1) muton
(2) cistron
(3) operon
(4) recon (NEET-II 2016)
✅ (2) cistron
Model Questions
64. Which statement is incorrect about transcription?
(1) It is the process of copying genetic information from one strand of the DNA into RNA
(2) Adenine pairs with uracil instead of thymine
(3) An initiation factor (σ factor) present in RNA polymerase initiates transcription
(4) It takes place in 3’→5’direction
✅ (4) It takes place in 3’→5’direction
65. DNA template sequence of CTGATAAGC is transcribed over mRNA is
(1) GUCTUTCG
(2) GACUAUUCG
(3) GAUTATUG
(4) UACTATCU
✅ (2) GACUAUUCG
66. Reverse transcriptase is
(1) RNA dependent RNA polymerase
(2) DNA dependent RNA polymerase
(3) DNA dependent DNA polymerase
(4) RNA dependent DNA polymerase
✅ (4) RNA dependent DNA polymerase
67. Functional unit of gene that specifies synthesis of one polypeptide is
(1) Codon
(2) Recon
(3) Cistron
(4) Muton
✅ (3) Cistron
68. Which is incorrect about Monocistronic structural genes?
(1) It is seen in prokaryotes
(2) It is a type of structural gene
(3) It is also known as split genes
(4) Coding sequences (exons) are interrupted by introns
✅ (1) It is seen in prokaryotes
69. The portion of a eukaryotic gene which is transcribed but not translated is
(1) Exon
(2) Intron
(3) Cistron
(4) Codon
✅ (2) Intron
70. Spliceosomes -the complex molecule necessary for processing of mRNA- are not found in cells of
(1) Bacteria
(2) Animals
(3) Fungi
(4) Plants
✅ (1) Bacteria
71. Methyl guanosine triphosphate is associated with
(1) Point mutation
(2) Tautomerism
(3) Capping
(4) Tailing
✅ (3) Capping
Topic 5: GENETIC CODE AND TRANSLATION
NEET: Previous Years Questions
72. Which of the following RNAs is not required for the synthesis of protein?
(1) mRNA
(2) tRNA
(3) rRNA
(4) siRNA (NEET 2021)
✅ (4) siRNA
73. Statement I: The codon 'AUG' codes for methionine and phenylalanine.
Statement II: 'AAA' and 'AAG' both codons code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
(1) Both statement I and Statement II are true.
(2) Both Statement I and Statement II are false
(3) Statement I is correct but Statement II is false
(4) Statement I is incorrect but Statement II is true (NEET 2021)
✅ (4) Statement I is incorrect but Statement II is true
74. The first phase of translation is:
(1) Aminoacylation of tRNA
(2) Recognition of an anti-codon
(3) Binding of mRNA to ribosome
(4) Recognition of DNA molecule (NEET 2020)
✅ (1) Aminoacylation of tRNA
75. Under which of the following conditions will there be no change in the reading frame of following mRNA?
5'- AACAGCGGUGCUAUU- 3'
(1) Insertion of G at 5th position
(2) Deletion of G from 5th position
(3) Insertion of A at G at 4th and 5th positions respectively
(4) Deletion of GGU from 7th, 8th and 9th positions (NEET 2019)
✅ (4) Deletion of GGU from 7th, 8th and 9th positions
76. Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?
(1) Genetic code is not ambiguous
(2) Genetic code is redundant
(3) Genetic code is nearly universal
(4) Genetic code is specific (NEET 2019)
✅ (3) Genetic code is nearly universal
77. Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?
(1) 5S rRNA
(2) 18S rRNA
(3) 23S rRNA
(4) 5.8S rRNA (NEET-II 2016)
✅ (3) 23S rRNA
78. If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?
(1) 11
(2) 33
(3) 333
(4) 1 (NEET 2017)
✅ (2) 33
79. Which one of the following is the starter codon?
(1) UAA
(2) UAG
(3) AUG
(4) UGA (NEET-I 2016)
✅ (3) AUG
80. A complex of ribosomes attached to a single strand of RNA is known as
(1) polypeptide
(2) Okazaki fragment
(3) polysome
(4) polymer (NEET-I 2016)
✅ (3) polysome
Model Questions
81. Initiation codons for protein synthesis are
(1) UUU and GGG
(2) AAU and UAA
(3) AUG and GUA
(4) GUG and AUG
✅ (4) GUG and AUG
82. Genetic code is said to be degenerate because
(1) Codon degenerate very quickly
(2) One amino acid is coded by more than one codon
(3) One codon codes for more than one amino acid
(4) None of the above
✅ (2) One amino acid is coded by more than one codon
83. Termination of polypeptide chain is brought about by
(1) UUG, UAG & UCG
(2) UAA, UAG & UGA
(3) UUG, UGC & UCA
(4) UCG, GCG & ACC
✅ (2) UAA, UAG & UGA
84. Match the codons with their respective amino acids and choose the correct answer.
a b c d e
(1) 3 4 1 5 2
(2) 3 1 4 5 2
(3) 3 4 5 1 2
(4) 2 4 1 5 3
✅ (1) 3 4 1 5 2
85. mRNA is polymer of
(1) Ribonucleotides
(2) Deoxyribonucleotides
(3) Ribonucleosides
(4) Deoxyribonucleosides
✅ (1) Ribonucleotides
86. Dr Khorana and his colleagues synthesized an RNA molecule with repeating sequence of UG N-bases (UG UG UG UG UG UG). It produced a tetrapeptide with alternating sequence of cystein and valine. It proves that codons for cystein and valine are
(1) UGU and GUU
(2) UGU and GUG
(3) UUG and GGU
(4) GUG and UGU
✅ (2) UGU and GUG
87. Which of the character is not applicable to tRNA?
(1) It is the smallest of the RNAs
(2) It acts as an adapter for amino acid
(3) It has a clover leaf like structure
(4) It is the largest of the RNAs
✅ (4) It is the largest of the RNAs
88. Which is not involved in protein synthesis?
(1) Transcription
(2) Initiation
(3) Elongation
(4) Termination
✅ (1) Transcription
89. Choose the wrong statements related to protein synthesis.
(1) After uncoiling of DNA molecule, one strand acts as a template for the formation of mRNA
(2) In the presence of DNA polymerase enzyme the mRNA is formed based on the triplet codes
(3) The mRNA that leaves nucleus reaches cytoplasm and gets attached with 30S ribosomal subunit
(4) The amino acids are transferred from the intracellular amino acid pool to the active ribosomes by the tRNA
✅ (2) In the presence of DNA polymerase enzyme the mRNA is formed based on the triplet codes
90. The reaction, Amino acid + ATP → Aminoacyl AMP + P – P depicts
(1) Amino acid assimilation
(2) Amino acid transformation
(3) Amino acid activation
(4) Amino acid translocation
✅ (3) Amino acid activation
91. What would be the anti-codon on the tRNA molecule that picks up and brings the amino acid methionine?
(1) UAC
(2) AUG
(3) CAU
(4) GUA
✅ (1) UAC
92. UTRs are present in
(1) A- site
(2) P-site
(3) mRNA
(4) tRNA
✅ (3) mRNA
93. The codon for Anticodon 3’-UUA-5’ is
(1) 5’-AAU-3’
(2) 5’-UAA-3’
(3) 3’-UAA-5’
(4) 3’-AAU-5’
✅ (1) 5’-AAU-3’
94. Cytosine base inserted in the beginning of DNA codons ATGATGATG will produce
(1) C ATG ATG ATG
(2) CAT GAT GAT G
(3) CA TGA TGA TG
(4) Non-sense mutation
✅ (2) CAT GAT GAT G
Topic 6: REGULATION OF GENE EXPRESSION AND OPERON CONCEPT
NEET: Previous Years Questions
95. The lactose present in the growth medium of bacteria is transported to the cell by the action of
(1) Beta-galactosidase
(2) Acetylase
(3) Permease
(4) Polymerase (NEET 2024)
✅ (3) Permease
96. Match List I with List II.
Choose the correct answer from the options given below:
(1) A-II, B-III, C-IV, D-I
(2) A-III, B-IV, C-I, D-II
(3) A-III, B-I, C-IV, D-II
(4) A-II, B-I, C-IV, D-III (NEET 2023)
✅ (1) A-II, B-III, C-IV, D-I
97. Match the following genes of the Lac operon with their respective products.
Select the correct option.
(a) (b) (c) (d)
(1) (i) (iii) (ii) (iv)
(2) (iii) (i) (ii) (iv)
(3) (iii) (i) (iv) (ii)
(4) (iii) (iv) (i) (ii) (NEET 2019)
✅ (3) (iii) (i) (iv) (ii)
98. All of the following are part of an operon except
(1) an operator
(2) structural genes
(3) an enhancer
(4) a promoter (NEET 2018)
✅ (3) an enhancer
99. Which of the following is required as inducer(s) for the expression of Lac operon?
(1) Lactose
(2) Lactose and galactose
(3) Glucose
(4) Galactose (NEET-I 2016)
✅ (1) Lactose
Model Questions
100. In prokaryotes, which level of gene expression is absent?
(1) Transcriptional level
(2) Processing level
(3) Transport of mRNA from nucleus to cytoplasm
(4) Translational level
✅ (2) Processing level
101. Operon is
(1) A set of closely linked genes regulating a metabolic pathway in prokaryotes
(2) The sequence of 3 nitrogen bases determining a single amino acid
(3) The sequence of nitrogen bases in mRNA which codes for single amino acid
(4) A segment of DNA specifying one polypeptide chain in protein synthesis
✅ (1) A set of closely linked genes regulating a metabolic pathway in prokaryotes
102. Regulatory genes are located
(1) Along with the structural genes
(2) In between operator and structural genes
(3) At the end of the structural genes
(4) In front of the structural genes
✅ (4) In front of the structural genes
103. Three enzymes required to breakdown lactose into glucose and galactose are
(1) β-galactosidase, permease and transacetylase
(2) β-galactosidase, phosphoglucose isomerase and phyrophosphorylase
(3) Phosphoglucomutase, permease and glycogen synthetase
(4) β-galactosidase, phosphate isomerase and transacetylase
✅ (1) β-galactosidase, permease and transacetylase
Topic 7: HUMAN GENOME PROJECT & DNA FINGERPRINTING
NEET: Previous Years Questions
104. Expressed Sequence Tags (ESTs) refers to
(1) All genes that are expressed as proteins.
(2) All genes whether expressed or unexpressed.
(3) Certain important expressed genes.
(4) All genes that are expressed as RNA. (NEET 2023)
✅ (4) All genes that are expressed as RNA.
105. DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as:
(1) Satellite DNA
(2) Repetitive DNA
(3) Single nucleotides
(4) Polymorphic DNA (NEET 2021)
✅ (2) Repetitive DNA
106. Expressed Sequence Tages (ESTs) refers to
(1) Genes expressed as RNA
(2) Polypeptide expression
(3) DNA polymorphism
(4) Novel DNA sequences (NEET 2019)
✅ (1) Genes expressed as RNA
107. Select the correct match:
(1) Alec Jeffreys - Streptococcus pneumoniae
(2) Alfred Harshey and Martha Chase - TMV
(3) Matthew Meselson and F. Stahl - Pisum sativum
(4) Francis Jacob and Jacques Monod - Lac operon (NEET 2018)
✅ (4) Francis Jacob and Jacques Monod - Lac operon
Model Questions
108. Which is not correct statement about Human genome?
(1) Largest known human gene (dystrophin on X-chromosome) contains 2.4 million bases
(2) 99.9% nucleotide bases are identical in all people
(3) About 1.4 million locations where single-base DNA differences (‘snips’) occur in humans
(4) Y Chromosome has most genes (2968) and Chromosome I has the fewest (231)
✅ (4) Y Chromosome has most genes (2968) and Chromosome I has the fewest (231)
109. In HGP, of the 24 chromosomes (22 autosomes and X & Y), the last sequenced one is
(1) Chromosome 1
(2) Chromosome 2
(3) X Chromosome
(4) Y Chromosome
✅ (1) Chromosome 1
110. In a genome, "snips" means
(1) Presence of short tandem repeats
(2) Presence of repeated (repetitive) DNA sequences
(3) Presence of single-base DNA differences
(4) Presence of non-coding DNA sequences
✅ (3) Presence of single-base DNA differences
111. Human genome project was closely associated with
(1) Information technology
(2) Bioinformatics
(3) Biophysics
(4) Bionomics
✅ (2) Bioinformatics
112. The basis of DNA fingerprinting is
(1) The double helix
(2) Errors in base sequence
(3) Polymorphism in sequence
(4) DNA replication
✅ (3) Polymorphism in sequence
113. Size of VNTR varies from
(1) 10 to 20 kb
(2) 1 to 10 kb
(3) 0.1 to 1 kb
(4) 0.1 to 20 kb
✅ (4) 0.1 to 20 kb
114. Which one is not involved in DNA fingerprinting?
(1) Digestion of DNA by restriction endonucleases
(2) Gel electrophoresis
(3) Reverse transcription of hybridized DNA
(4) Autoradiography
✅ (3) Reverse transcription of hybridized DNA
What a selfless service it is. Great Service
ReplyDeleteGod bless u sir
ReplyDelete